View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14959_low_9 (Length: 305)
Name: NF14959_low_9
Description: NF14959
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14959_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 5 - 293
Target Start/End: Complemental strand, 5995384 - 5995096
Alignment:
| Q |
5 |
gagaagaaaagttttggttctgttttcaatagtttttataagcttgaaagtgaatattatgatcattacaagaaagttatgggaactaaaagttggggac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995384 |
gagaagaaaagttttggttctgttttcaatagtttttataagcttgaaagtgaatattatgatcattacaagaaagttatgggaactaaaagttggggac |
5995285 |
T |
|
| Q |
105 |
ttggacctgtttctttatgggctaatcaagatgattcagataaagctgcaagagggtatgcaaagaaagaagaaggtgcaaaagaagaagggtggttgaa |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995284 |
ttggacctgtttctttatgggctaatcaagatgattcagataaagctgcaagagggtatgcaaggaaagaagaaggtgcaaaagaagaagggtggttgaa |
5995185 |
T |
|
| Q |
205 |
atggttgaattcaaaaccagatggttctgttttatatgtaagttttggcagtatgaataaatttccttattctcagttagttgaaattg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5995184 |
atggttgaattcaaaaccagatggttctgttttatatgtaagttttggcagtatgaataaatttccttattctcagttagttgaaattg |
5995096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University