View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1495_low_13 (Length: 215)
Name: NF1495_low_13
Description: NF1495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1495_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 90 - 199
Target Start/End: Complemental strand, 29715609 - 29715500
Alignment:
| Q |
90 |
atttgtgattagtattcacagttttcatccctttgttgtagaacattttacacgacggttatgatggtggtgatgataaccctaaggatcgagatgctcc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29715609 |
atttgtgattagtattcacagttttcatccctttgttgtagaacattttacacgacggttatgatggtggtgatgataaccctaaggatcgagatgctcc |
29715510 |
T |
 |
| Q |
190 |
tctagataat |
199 |
Q |
| |
|
||||| |||| |
|
|
| T |
29715509 |
tctaggtaat |
29715500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 29715767 - 29715704
Alignment:
| Q |
17 |
atacttttcatctttaaaatgaatcaaaaatttaattttaaataagggcaatttgaatattata |
80 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29715767 |
atacttttaatctttaaaatgaatcaaaaatttaattttaaataagggcaatttgaatattata |
29715704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University