View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1495_low_6 (Length: 328)
Name: NF1495_low_6
Description: NF1495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1495_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 16 - 314
Target Start/End: Complemental strand, 42094871 - 42094573
Alignment:
| Q |
16 |
acccgatttacaagatggaaggtggagattcagcctttcaattggacaagtcaggtcccttttacttcattagtggaaacgttgagaattgccaaaaggg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42094871 |
acccgatttacaagatggaaggtggagattcagcctttcaattggacaagtcaggtcccttttacttcattagtggaaacgttgagaattgccaaaaggg |
42094772 |
T |
|
| Q |
116 |
tagaaagttaaacgttgtcgcttggtttccacatcggcgattaatgtctctagctgcggatgctcctccgccaagtatggtacaagttccagcaatgtct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42094771 |
tagaaagttaaacgttgtcgcttggtttccacatcggcgattaatgtctctggcagcggatgctccttcgccaagtatggtacaagttccagcaatgtct |
42094672 |
T |
|
| Q |
216 |
cctacagtcaatgctccgacaccaaatgtcattggctggaatgctcctgcgccaagtgctgccgacattcatgctccatcaccaagtccaacaaccaat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42094671 |
cctacagtcaatgctccgacaccaaatgtcattggctggaatgctcctgcgccaagtcctgccgacattcatgctccatcaccaagtccaacaaccaat |
42094573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 38 - 133
Target Start/End: Complemental strand, 38719994 - 38719899
Alignment:
| Q |
38 |
tggagattcagcctttcaattggacaagtcaggtcccttttacttcattagtggaaacgttgagaattgccaaaagggtagaaagttaaacgttgt |
133 |
Q |
| |
|
|||||||||| ||||| |||| ||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||| |||||| | |||||| |
|
|
| T |
38719994 |
tggagattcaacctttaaatttgacaagtcaggtccctttttcttcatcagtggaatcgttgagaattgccaaaagggtgaaaagttgatcgttgt |
38719899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 56 - 94
Target Start/End: Complemental strand, 38711448 - 38711410
Alignment:
| Q |
56 |
attggacaagtcaggtcccttttacttcattagtggaaa |
94 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
38711448 |
attggacaaatcaggtcccttttacttcatcagtggaaa |
38711410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University