View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14960_high_5 (Length: 344)
Name: NF14960_high_5
Description: NF14960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14960_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 27 - 271
Target Start/End: Original strand, 4229849 - 4230087
Alignment:
| Q |
27 |
ggcacaagcgtaatgcctaagcttcgttgtgtggcttctttaagaagctcacaaagacgtgttagcgcatgccacgcaaaaaactcataaagaagggtta |
126 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4229849 |
ggcacaagcttaatgcctaagcttcgttgtgtggcttctttaagaagctcacaaagacgtgttagggcatgccacgcaaaaaactcataaagaagggtta |
4229948 |
T |
 |
| Q |
127 |
tgtttgtatgttgcatgcgagtttatttcaacttgaaatgacaaaaacatccctccaatttgaccaccacttgtttatccaatcaacaaggaaacgtcga |
226 |
Q |
| |
|
|||||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4229949 |
tgtttgcgagt--catt----tttatttcaacttgaaatgacaaaaacatccctccaatttgaccaccacttgtttatccaatcaacaaggaaacgtcga |
4230042 |
T |
 |
| Q |
227 |
tgacttgggagtcaagtttcgtgtagcatatcttaacttctcttc |
271 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4230043 |
tgacttgggagccaagtttcgtgtagcatatcttaacttctcttc |
4230087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 308 - 340
Target Start/End: Original strand, 4230174 - 4230206
Alignment:
| Q |
308 |
gctttatttagtacattcgtgctccctatgcta |
340 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
4230174 |
gctttatttagtacattcgtgctccctaagcta |
4230206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University