View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14960_high_6 (Length: 302)
Name: NF14960_high_6
Description: NF14960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14960_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 42690997 - 42690779
Alignment:
| Q |
1 |
agagtgttttgtttgcgtttctttgttttgtatttgctgtgattggtgggaagaagaaggtgtgatactgatagcattgagtggagaggaacgcgatggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42690997 |
agagtgttttgtttgcgtttctttgttttgtatttgctgtgattggtgggaagaagaaggtgtgatactgatagcattgagtggagaggaacacgatggc |
42690898 |
T |
|
| Q |
101 |
ctcttatttgagggataagataatggcaatctaacgtgtggacgtatttgggagagaagaggatttggttttcaaatttcctactttgtcnnnnnnncca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42690897 |
ctcttatttgagggataagataatggcaatctaacgtgtggacgtatttgggagagaagaggatttggttttcaaatttcctactttgtctttttttcca |
42690798 |
T |
|
| Q |
201 |
caagatcctactttgtgtt |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
42690797 |
caagatcctactttgtgtt |
42690779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University