View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14960_low_2 (Length: 466)
Name: NF14960_low_2
Description: NF14960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14960_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 125 - 448
Target Start/End: Complemental strand, 1780659 - 1780340
Alignment:
| Q |
125 |
gggtttatatattgtctttgtttgttgtgttggtgttgacaaacaaacctaaagccaaaggagttttggctttggtggtgtggactgtgggccctaccta |
224 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1780659 |
gggtttatatattgtctttgttggttgtgttggtgttgacaaacaaacctaaagccaaaggagttttggctttggtggtgtggactgtgggccctaccta |
1780560 |
T |
 |
| Q |
225 |
ccccttttgtataacgtggcattccatctactctctttattttactctttttcttgttttccaatttttgatgtaataaacgaaatagacgtgttccgtg |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1780559 |
ccccttttgtataacgtggcattccatctactctctttattttactctttttcttgttttccaatttttgatgtaataaacgaaatagatgtgttccgtg |
1780460 |
T |
 |
| Q |
325 |
agnnnnnnnnngtgtaactgagatttgaacccggaatcttgtatataatatgcattatttatggcaactgaactaagcttatgagaactgataaaatata |
424 |
Q |
| |
|
|| ||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1780459 |
agtttttttg---gtaaccgagatttgaa-cttgaatcttgtatataatatgcattatttatggcaactgaactaagcttatgagaactgataaaatata |
1780364 |
T |
 |
| Q |
425 |
gtttatgtataggattgaagtttg |
448 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
1780363 |
gtttatgtataggattggagtttg |
1780340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 11 - 61
Target Start/End: Complemental strand, 1780773 - 1780723
Alignment:
| Q |
11 |
gagatgaagatgtggttgcgaagaaaaagggattgagagagagtttgtgtt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1780773 |
gagatgaagatgtggttgcgaagaaaaagggattgagagagagtttgtgtt |
1780723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 348 - 412
Target Start/End: Original strand, 23686302 - 23686366
Alignment:
| Q |
348 |
tttgaacccggaatcttgtatataatatgcattatttatggcaactgaactaagcttatgagaac |
412 |
Q |
| |
|
||||||||| |||||||| ||||| ||| ||||||||||| |||||| ||||||| | |||||| |
|
|
| T |
23686302 |
tttgaaccccgaatcttgcatatattatacattatttatgctaactgagctaagctcacgagaac |
23686366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University