View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14961_high_20 (Length: 245)
Name: NF14961_high_20
Description: NF14961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14961_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 46097274 - 46097062
Alignment:
| Q |
14 |
ataattctcatcttgcatttcaattttatactgttgaattatgctcaaaatactgtaaaatatattttgttaaagatagcttatgcaaatatgccctgaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46097274 |
ataattctcatcttgcatttcaattttatactgttgaattatgctcaaaatactgtaaaatatattttgttaaagatagcttatgcaaatatgccctgaa |
46097175 |
T |
 |
| Q |
114 |
ttttgagaaagggatccaatgtgagataattgtcgtgaatttgaatcttcttttatttttcaataagataatattgttacaaagaaaaagacaggcgaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46097174 |
ttttgagaaagggatccaatgtgagataattgtcgtgaatttgaatcttcttttatttttcaataagataatattgttacaaagaaaaagacaggcgaaa |
46097075 |
T |
 |
| Q |
214 |
tgagctggcttat |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
46097074 |
tgagctggcttat |
46097062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University