View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14961_high_26 (Length: 212)

Name: NF14961_high_26
Description: NF14961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14961_high_26
NF14961_high_26
[»] chr2 (1 HSPs)
chr2 (13-212)||(27873801-27873997)


Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 13 - 212
Target Start/End: Complemental strand, 27873997 - 27873801
Alignment:
13 aatataattagttatgaagtctttatgatatatttattggtaaggggcggtggagcaatctgatcaaaatggcgtcattgatgccatattttcattaact 112  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||      
27873997 aatataattagttatgaagtctttatgatatatttatgggtaaggggcggtggagcaatctgatcaaaatggcgtcatggatgccatattttcattaata 27873898  T
113 tagatatnnnnnnnnnnnnntagaagactttaaattcagactttatgataaatttatgagacataaatacagagtacataggaacgaaaactcgagtaac 212  Q
    |||||||             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
27873897 tagatat---aaaaaaaaaatggaagactttaaattcagactttatgataaatttatgagacataaatacagagtacatgggaacgaaaactcgagtaac 27873801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University