View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14961_low_16 (Length: 306)
Name: NF14961_low_16
Description: NF14961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14961_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 293
Target Start/End: Complemental strand, 45692376 - 45692102
Alignment:
| Q |
19 |
taagcatcagtagatgcatgcatgcatgtgtgcaaatacatgttggttttgatttgaagttaagaagcgtcttattggaacaacttaacgttcagttgta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45692376 |
taagcatcagtagatgcatgcatgcatgtgtgcaaatacatgttggttttgatttgaagttaagaagcgtcttattggaacaacttagcgttcagttgta |
45692277 |
T |
 |
| Q |
119 |
cttgcaggttatgacttatcgcggctaaattaaaagaatacagtctttcagaaatgagtcgaaattctcttgatctcatctctgcaaggtcagtctagac |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45692276 |
cttgcaggttatgacttattgcggctaaattaaaagaatacagtctttcagaaatgagtcgaaattctcttgatctcatctctgcaagttcagtctagac |
45692177 |
T |
 |
| Q |
219 |
tctacagtacaagaggaaacttaaaagtcattgaggttgggattccaattgttgacttgccaaattgcacaggtt |
293 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45692176 |
tctacagtacaagaggatacttaaaagtcattgaggttgggattccaattgttgacttgccaaattgcacaggtt |
45692102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University