View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14961_low_17 (Length: 289)
Name: NF14961_low_17
Description: NF14961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14961_low_17 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 92 - 289
Target Start/End: Original strand, 22714571 - 22714769
Alignment:
| Q |
92 |
ggactgaagttgaattgaataatgagagaagaggtaaggagtaaagtcgggactggattcctctgctgatattgtcttttaataaccaatcaattttgca |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22714571 |
ggactgaagttgaattgaataatgagagaagaagtaaggagtaaagtcgggactggattcctctgctgatattgtcttttaataaccaatcaattttgca |
22714670 |
T |
 |
| Q |
192 |
gtccaagacatggggcaattgtgcagagagggtcaaattcttcatgtgtggccctataatcaaa-ggtccaaactccattatcccatgtcttgtggggc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
22714671 |
gtccaagacatggggcaattgtgcagagagggtcaaattcttcatgtgtggccctataatcaaagggtccaaactccattaccccatgtcttgtggggc |
22714769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University