View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14961_low_25 (Length: 227)

Name: NF14961_low_25
Description: NF14961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14961_low_25
NF14961_low_25
[»] chr3 (1 HSPs)
chr3 (12-192)||(51231951-51232130)


Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 12 - 192
Target Start/End: Complemental strand, 51232130 - 51231951
Alignment:
12 tttcttctcacttcagtatagtaaatctaaaatctgaaaaccgatctatatatggagtctgttacattgtctccataccataccatagctaactaggata 111  Q
    ||||| |||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51232130 tttctcctcacttcagtatagtaa-tctaaaatctaataaccgatctatatatggagtctgttacattgtctccataccataccatagctaactaggata 51232032  T
112 ggtagtggttatattatatagccaaccaaggcatgtgattcctttttagactaaagattcagggccaacaatgattgttag 192  Q
    ||||||||  |||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||    
51232031 ggtagtggagatattatatagccaaccaaggcatgtgattgcttttaagactaaagattcagggccaacaatgattgttag 51231951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University