View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14961_low_25 (Length: 227)
Name: NF14961_low_25
Description: NF14961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14961_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 12 - 192
Target Start/End: Complemental strand, 51232130 - 51231951
Alignment:
| Q |
12 |
tttcttctcacttcagtatagtaaatctaaaatctgaaaaccgatctatatatggagtctgttacattgtctccataccataccatagctaactaggata |
111 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51232130 |
tttctcctcacttcagtatagtaa-tctaaaatctaataaccgatctatatatggagtctgttacattgtctccataccataccatagctaactaggata |
51232032 |
T |
 |
| Q |
112 |
ggtagtggttatattatatagccaaccaaggcatgtgattcctttttagactaaagattcagggccaacaatgattgttag |
192 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51232031 |
ggtagtggagatattatatagccaaccaaggcatgtgattgcttttaagactaaagattcagggccaacaatgattgttag |
51231951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University