View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14961_low_27 (Length: 212)
Name: NF14961_low_27
Description: NF14961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14961_low_27 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 13 - 212
Target Start/End: Complemental strand, 27873997 - 27873801
Alignment:
| Q |
13 |
aatataattagttatgaagtctttatgatatatttattggtaaggggcggtggagcaatctgatcaaaatggcgtcattgatgccatattttcattaact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27873997 |
aatataattagttatgaagtctttatgatatatttatgggtaaggggcggtggagcaatctgatcaaaatggcgtcatggatgccatattttcattaata |
27873898 |
T |
 |
| Q |
113 |
tagatatnnnnnnnnnnnnntagaagactttaaattcagactttatgataaatttatgagacataaatacagagtacataggaacgaaaactcgagtaac |
212 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27873897 |
tagatat---aaaaaaaaaatggaagactttaaattcagactttatgataaatttatgagacataaatacagagtacatgggaacgaaaactcgagtaac |
27873801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University