View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14961_low_5 (Length: 472)
Name: NF14961_low_5
Description: NF14961
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14961_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 4e-85; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 1 - 160
Target Start/End: Complemental strand, 27873815 - 27873656
Alignment:
| Q |
1 |
gaaaactcgagtaactgcagacctgctgttacattaaaatgcaaaagtttaacacacataaccatacaaattgaattctaactttgttctataaatttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27873815 |
gaaaactcgagtaactgcagacctgctgttacattaaaatgcaaaagtttaacacacataaccatacaaattgaattctaactttgttctataaatttga |
27873716 |
T |
 |
| Q |
101 |
taaagaataagagattaaaaaattcctaaacaaattgaattttaaatttgttttatttgc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27873715 |
taaagaataagagattaaaaaattcctaaacaaattgaattttaaatttgttttatttgc |
27873656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 243 - 294
Target Start/End: Complemental strand, 27873572 - 27873520
Alignment:
| Q |
243 |
cttcttgatcaagcattccatagaccacataa-aaaatctgcttccacatgtg |
294 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27873572 |
cttcttaatcaagcattccatagaccacataaaaaaatctgcttccacatgtg |
27873520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 364 - 398
Target Start/End: Complemental strand, 27873453 - 27873419
Alignment:
| Q |
364 |
ccatgattgaagaactatgaatcataaaccattgt |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27873453 |
ccatgattgaagaactatgaatcataaaccattgt |
27873419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 179 - 210
Target Start/End: Complemental strand, 27873639 - 27873608
Alignment:
| Q |
179 |
tccttcaattaccatgtttctcttcaaccaat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27873639 |
tccttcaattaccatgtttctcttcaaccaat |
27873608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University