View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14962_high_4 (Length: 236)
Name: NF14962_high_4
Description: NF14962
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14962_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 54 - 228
Target Start/End: Complemental strand, 27359740 - 27359566
Alignment:
| Q |
54 |
gtgcaagtatgagtggtgtgataacttaaactaaaattgtctaataaatcatgggaaaactaagattttttcataggcgaaccaacactagttgagttta |
153 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27359740 |
gtgcaagtatgagtggtatgataacttaaactaaaattgtctaataaatcatgggaaaactaagattttttcataggtgaaccaacactagttgagttta |
27359641 |
T |
|
| Q |
154 |
gcaagttgttagcaatgatgtgagttgtgtttatctgaggtgtgtaaaggctagtgctatatttgctttgatgat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27359640 |
gcaagttgttagcaatgatgtgagttgtgtttatctgaggtgtgtaaaggctagtgctatatttgctttgatgat |
27359566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University