View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14963_low_9 (Length: 263)
Name: NF14963_low_9
Description: NF14963
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14963_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 10 - 254
Target Start/End: Complemental strand, 1885722 - 1885478
Alignment:
| Q |
10 |
tattttgttgcgccaaatttgcttccaattaccatcaattccgtgctgatgagaatttacatccttttccatgatgctcctgtatgcgctacgaacggaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885722 |
tattttgttgcgccaaatttgcttccaattaccatcaattccgtgctgatgagaatttacatccttttccatgatgctcctgtatgcgctacgaacggaa |
1885623 |
T |
 |
| Q |
110 |
tagatactgtttttctcaagtttccacacacatctatcttgctgcgcggtagaaatcagaggtgttctgcgaatttgataagctgaaatgttgtcaaata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1885622 |
tagatactgtttttctcaagtttccacacacatctatcttgctgcgcggtagaaatcagaggtgttctgcgaatttgataagctgaaatgttgtcaaata |
1885523 |
T |
 |
| Q |
210 |
aataatattctccatctgccattgtttggtgtatcctttgcttct |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1885522 |
aataatattctccatctgccattgtttggtgtatcctttgtttct |
1885478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University