View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14964_high_13 (Length: 295)
Name: NF14964_high_13
Description: NF14964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14964_high_13 |
 |  |
|
| [»] scaffold0016 (4 HSPs) |
 |  |  |
|
| [»] scaffold0272 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 259
Target Start/End: Original strand, 21313031 - 21313288
Alignment:
| Q |
1 |
tcatcgcagcaatttgatagagaaagagaactaaggaaagaggagaatgacgaagatgcttctttagatgcacacgaaacattgtacttaccatgcaagc |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21313031 |
tcatagcagcaatttgatagagaaagagaactaaggaa-gaggacaatgacgaagatgcttctttagatgcacacgaaacattgtacttaccatgcaagc |
21313129 |
T |
 |
| Q |
101 |
ttagattagaagctggttgcgctggtgagtcaaacacgatagttaaggtaatttcaaggctgtcttttccttctacattagactccttaagaggatcact |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21313130 |
ttggattagaagctggttgcgctggtgagtcatacacgaaagtgaaggtaatttcaaggctgtcttttccttctacattagactccttaagaggatcact |
21313229 |
T |
 |
| Q |
201 |
ggtcctttcaactcgtccatgaaattcataagatatataacaacacgatcatgtgtata |
259 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21313230 |
ggtcctttcaattcgtccatgaaattcataagatatataacaacatgatcatgtgtata |
21313288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 33715339 - 33715380
Alignment:
| Q |
140 |
tagttaaggtaatttcaaggctgtcttttccttctacattag |
181 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33715339 |
tagtgaaggtaatttcaaggctgtcttttccttctacattag |
33715380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 145 - 181
Target Start/End: Original strand, 21137509 - 21137545
Alignment:
| Q |
145 |
aaggtaatttcaaggctgtcttttccttctacattag |
181 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21137509 |
aaggtaatttcatggctgtcttttccttctacattag |
21137545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 37; Significance: 0.000000000007; HSPs: 4)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 145 - 181
Target Start/End: Complemental strand, 61449 - 61413
Alignment:
| Q |
145 |
aaggtaatttcaaggctgtcttttccttctacattag |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
61449 |
aaggtaatttcaaggctgtcttttccttctacattag |
61413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 145 - 180
Target Start/End: Complemental strand, 71643 - 71608
Alignment:
| Q |
145 |
aaggtaatttcaaggctgtcttttccttctacatta |
180 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
71643 |
aaggtaatttcaaggctgtcttttccctctacatta |
71608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 46804 - 46763
Alignment:
| Q |
140 |
tagttaaggtaatttcaaggctgtcttttccttctacattag |
181 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
46804 |
tagtgaagttaatttcaaggctgtcttttccttctatattag |
46763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 38 - 99
Target Start/End: Complemental strand, 74890 - 74829
Alignment:
| Q |
38 |
aagaggagaatgacgaagatgcttctttagatgcacacgaaacattgtacttaccatgcaag |
99 |
Q |
| |
|
||||||||||| | |||| ||||| ||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
74890 |
aagaggagaataatgaaggtgctttattagatgaacatgaaacattgtccttaccatgcaag |
74829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 145 - 180
Target Start/End: Complemental strand, 10345 - 10310
Alignment:
| Q |
145 |
aaggtaatttcaaggctgtcttttccttctacatta |
180 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10345 |
aaggtaatttcaaggctgtcttttccctctacatta |
10310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University