View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14964_high_14 (Length: 292)
Name: NF14964_high_14
Description: NF14964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14964_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 17 - 283
Target Start/End: Original strand, 24261202 - 24261468
Alignment:
| Q |
17 |
acacagttatatagattaatagtgcgatgtgtctgatcattattatagccgttgtctttgtgaaattgcttagtgaccatgtcatcgtagtttaggaatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
24261202 |
acacagttatatagattaatagtgcgatgtgtctgatcattattatagccgttgtctttgtgaaattgcttagtgaccatgtcatcgcaatttaggaatt |
24261301 |
T |
 |
| Q |
117 |
taaacttctatgttgctattcaaatgtaatattgattaatctaacccttaaaatgcaatcttttagatgcaaacaagtggaagattagtgtgagtatcca |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24261302 |
taaacttctatgttgctattcaaatgtaatattgattaatctaacccttaaaatgcaatcttttagatgcaaacaagtggaagattagtgtgagtatccg |
24261401 |
T |
 |
| Q |
217 |
caatcaaacttaatcgagtgtttttggcaccggatgagactatgtctttgcctgcaagtgttcattt |
283 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24261402 |
caatcaaacttaatcgagtatttttggcaccggatgagactatgtctttgcctgcaagtgttcattt |
24261468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University