View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14964_high_6 (Length: 491)
Name: NF14964_high_6
Description: NF14964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14964_high_6 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 4e-64; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 4e-64
Query Start/End: Original strand, 194 - 318
Target Start/End: Complemental strand, 25371829 - 25371705
Alignment:
| Q |
194 |
cgaacaggtaattggttcgctgttctcatggagagaaattacgaattatgtgactacaaaacaccattcattgatataaacaatagcattacacgatatt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25371829 |
cgaacaggtaattggttcgctgttctcatggagagaaattacgaattatgtgactacaaaacaccattcattgatataaacaatagcattacacgatatt |
25371730 |
T |
|
| Q |
294 |
acatatgcataatttaagaaaatgc |
318 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
25371729 |
acatatgcataatttaagaaaatgc |
25371705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 444 - 491
Target Start/End: Complemental strand, 30897666 - 30897619
Alignment:
| Q |
444 |
atatgttcacttttcatggatttcccatcaaactttaaactaattgac |
491 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30897666 |
atatgttcacatttcatggatttaccatcaaactttaaactaattgac |
30897619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University