View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14964_low_17 (Length: 267)
Name: NF14964_low_17
Description: NF14964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14964_low_17 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 14 - 267
Target Start/End: Complemental strand, 26498896 - 26498643
Alignment:
| Q |
14 |
cataggactgaaaagtgggaccagcatcatttacagaaccttgatactcacgacccttagcaacattaaatttagtctttatactcccactccaccttct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26498896 |
cataggactgaaaagtgggaccagcatcatttacagaaccttgatacacacgacccttggaaacattaaatttagtctttatactcccactccaccttct |
26498797 |
T |
 |
| Q |
114 |
accttgcacatgcatcttctcatatccatcaccattaaaccacccttctctctcctcgcaatgcttaaattccttccacccttcagaaaattctgatccg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26498796 |
accttgcacatgcatcttctcatatccatcaccattaaaccacccttctctctcctcgcaatgcttaaattccttccacccttcagaaaattctgatccg |
26498697 |
T |
 |
| Q |
214 |
tcgtagggtggcgggaggaggtggaggaaggcggcgaaggcgaagtcatggttt |
267 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26498696 |
tcgtagggtggtgggaggaggtggaggaaggcggcgaaggcgaagtcatggttt |
26498643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 14 - 167
Target Start/End: Complemental strand, 26502379 - 26502226
Alignment:
| Q |
14 |
cataggactgaaaagtgggaccagcatcatttacagaaccttgatactcacgacccttagcaacattaaatttagtctttatactcccactccaccttct |
113 |
Q |
| |
|
|||| |||||||||||||| |||||||||| | |||||| ||||||||| || ||||||||||||||||| | ||||| ||||||||||||| || |
|
|
| T |
26502379 |
cataagactgaaaagtgggtccagcatcataaatagaaccctgatactcagtccctttagcaacattaaatttggcttttattttcccactccacctcct |
26502280 |
T |
 |
| Q |
114 |
accttgcacatgcatcttctcatatccatcaccattaaaccacccttctctctc |
167 |
Q |
| |
|
||||| | |||||||| ||||| |||||| | |||||||| ||||||||||| |
|
|
| T |
26502279 |
cccttgtaaatgcatctcttcatacccatcatccttaaaccatccttctctctc |
26502226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University