View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14965_high_10 (Length: 369)
Name: NF14965_high_10
Description: NF14965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14965_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 7e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 7e-74
Query Start/End: Original strand, 180 - 361
Target Start/End: Complemental strand, 24914717 - 24914536
Alignment:
| Q |
180 |
aatgttctttgtttatatttatatacttattcagtagtgggcttagatgttttggaannnnnnncaggaaaaaattgttgatcttgcaatcaagtcgtct |
279 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24914717 |
aatgttttttgtttatatttatatacttgttcagtagtgggcttagatgttttggattttttttcaggaaaaaattgttgatcttgcaatcaagtcgtct |
24914618 |
T |
 |
| Q |
280 |
aactctgctacgcaagtaaacattctcccagaaagagttgttgatcatacaaacaagtcgtcagacacttctgcgcaagcaa |
361 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24914617 |
aactctgctgcgcaagtaaacattctcccagaaagagttgttgatcatacaaaccagtcgtcagacacttctgcgcaagcaa |
24914536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 298 - 358
Target Start/End: Complemental strand, 24914530 - 24914470
Alignment:
| Q |
298 |
aacattctcccagaaagagttgttgatcatacaaacaagtcgtcagacacttctgcgcaag |
358 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||| ||||| || ||||||||| |
|
|
| T |
24914530 |
aacattctcccagaaagagttgtttatcatgcaaacaagtcatcagattctgctgcgcaag |
24914470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University