View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14965_high_32 (Length: 210)
Name: NF14965_high_32
Description: NF14965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14965_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 23840724 - 23840548
Alignment:
| Q |
16 |
ggtggaaagatgtcttattataagtttttcgtgctagtattgttacttgcagttactctcatcaccaatattgctgcagggaatccaaagcatcaacgac |
115 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23840724 |
ggtggaaagatgtcttattatgagtttttcgtgctagtattgttacttgcagttactctcatcaccaatattgctgcagggaatccaaagcatcaacgac |
23840625 |
T |
 |
| Q |
116 |
atgcgcaacccaatggtctgatcagttaccagccaccgaccattagtgctccacagatcaaacctattggtttcaat |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23840624 |
atgcgcaacccaatggtctgatcagttaccagccaccgaccattaatgctccacagatcaaacctattggtttcaat |
23840548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 22788508 - 22788616
Alignment:
| Q |
18 |
tggaaagatgtcttattataagtttttcgtgctagtattgttacttgcagtt---actctcatcaccaatattgctgcagggaatccaaagcatcaacga |
114 |
Q |
| |
|
|||||| |||||||||||||| || | |||| |||| ||||| ||||||||| ||| ||||||||||||| |||||| ||||||||||| ||| | |
|
|
| T |
22788508 |
tggaaaaatgtcttattataacttatccgtgttagttttgtttcttgcagttaacactatcatcaccaatat---tgcaggaaatccaaagcaccaaata |
22788604 |
T |
 |
| Q |
115 |
catgcgcaaccc |
126 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
22788605 |
cacgcgcaaccc |
22788616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 152
Target Start/End: Complemental strand, 20571246 - 20571184
Alignment:
| Q |
90 |
tgcagggaatccaaagcatcaacgacatgcgcaacccaatggtctgatcagttaccagccacc |
152 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||| || |||| | ||||| |||||||||||| |
|
|
| T |
20571246 |
tgcagggaatccaaagcatcaaatacatgcccaaaccgatggaccgatcatttaccagccacc |
20571184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 152
Target Start/End: Original strand, 23864559 - 23864621
Alignment:
| Q |
90 |
tgcagggaatccaaagcatcaacgacatgcgcaacccaatggtctgatcagttaccagccacc |
152 |
Q |
| |
|
|||||| | ||||||||||||| ||||||||||||| |||| | ||||| |||||||||||| |
|
|
| T |
23864559 |
tgcaggaagtccaaagcatcaaatacatgcgcaacccgatggaccgatcatttaccagccacc |
23864621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 25779465 - 25779357
Alignment:
| Q |
18 |
tggaaagatgtcttattataagtttttcgtgctagtattgttacttgcagtt---actctcatcaccaatattgctgcagggaatccaaagcatcaacga |
114 |
Q |
| |
|
|||||| |||||||||||||| || | |||| |||| ||||| ||||||||| ||| ||||||||||||| |||||| ||||||||||||||| | |
|
|
| T |
25779465 |
tggaaaaatgtcttattataacttatccgtgttagttttgtttcttgcagttaacactatcatcaccaatat---tgcaggaaatccaaagcatcaaata |
25779369 |
T |
 |
| Q |
115 |
catgcgcaaccc |
126 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
25779368 |
cacgcgcaaccc |
25779357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University