View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14965_high_6 (Length: 431)

Name: NF14965_high_6
Description: NF14965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14965_high_6
NF14965_high_6
[»] chr7 (1 HSPs)
chr7 (343-418)||(10210039-10210114)


Alignment Details
Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 343 - 418
Target Start/End: Original strand, 10210039 - 10210114
Alignment:
343 atgttggtaaaggagcacgtgctgctcgattacagagaaataaaatggtattgttatatctttatatgttccttgt 418  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
10210039 atgttggtaaaggtgcacgtgctgctcgattacagagaaataaaatggtactgttatatctttatatgttccttgt 10210114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University