View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14965_low_21 (Length: 323)
Name: NF14965_low_21
Description: NF14965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14965_low_21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 43439854 - 43440176
Alignment:
| Q |
1 |
ggctatgtaactcataaatgtacattctcnnnnnnngcatgcatagtgtggctttattttgctttaagctattttacatcattatattaattctgtgagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439854 |
ggctatgtaactcataaatgtacattctctttttttgcatgcatagtgtggctttattttactttaagctattttacatcattatattaattctgtgagt |
43439953 |
T |
|
| Q |
101 |
gttatcaagtttgttatttggtatcaagtatcaacatatatatcgtgactctttataatatgagcatgtcggagattcatgtatatatcaacccaattgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43439954 |
gttatcaagtttgttatttggtatcaagtatcaacatatatattgtgactctttataatatgagcatgtcggagattcatgtatatatcaacccaattgg |
43440053 |
T |
|
| Q |
201 |
aaataggctttaacaaagaccaagagaggccattgtctcttctatgagtggtgtattgatcctgtattttgcattggtaggccgtaggcatgcgttccct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43440054 |
aaataggctttaacaaagaccaagagaggtcattgtctcttctatgagtggtgtattgatcctgtattttgcattggtagggcgtaggcatgcgttccct |
43440153 |
T |
|
| Q |
301 |
tgagcttcctttgcttctcctct |
323 |
Q |
| |
|
||||||||||||| || |||||| |
|
|
| T |
43440154 |
tgagcttcctttgtttttcctct |
43440176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University