View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14965_low_23 (Length: 302)

Name: NF14965_low_23
Description: NF14965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14965_low_23
NF14965_low_23
[»] chr7 (1 HSPs)
chr7 (20-292)||(35363759-35364031)


Alignment Details
Target: chr7 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 20 - 292
Target Start/End: Original strand, 35363759 - 35364031
Alignment:
20 gtcgccgtcactgtcaaccacaatcaaagctgaaaataaaatataaatgtaacggggaccaagcaccagaagcaatcgggaacaaagcagtactagaata 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35363759 gtcgccgtcactgtcaaccacaatcaaagctgaaaataaaatataaatgtaacggggaccaagcaccagaagcaatcgggaacaaagcagtactagaata 35363858  T
120 tacattaagactcaaatatggcaatggggtagtccacctttattgaggagtaaaagcttaagtacgtaaatgatccatgcaaatactatgaattaagggc 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35363859 tacattaagactcaaatatggcaatggggtagtccacctttattgaggagtaaaagcttaagtacgtaaatgatccatgcaaatactatgaattaagggc 35363958  T
220 attggatttagtctttgtaaataattaaattagttttagttcttacaaatataatttttggttttggcctttg 292  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
35363959 attggatttagtctttgtaaataattaaattagtttcagttcttacaaatataatttttggttttggcctttg 35364031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University