View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14965_low_36 (Length: 210)

Name: NF14965_low_36
Description: NF14965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14965_low_36
NF14965_low_36
[»] chr2 (4 HSPs)
chr2 (16-192)||(23840548-23840724)
chr2 (18-126)||(22788508-22788616)
chr2 (90-152)||(20571184-20571246)
chr2 (90-152)||(23864559-23864621)
[»] chr6 (1 HSPs)
chr6 (18-126)||(25779357-25779465)


Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 23840724 - 23840548
Alignment:
16 ggtggaaagatgtcttattataagtttttcgtgctagtattgttacttgcagttactctcatcaccaatattgctgcagggaatccaaagcatcaacgac 115  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23840724 ggtggaaagatgtcttattatgagtttttcgtgctagtattgttacttgcagttactctcatcaccaatattgctgcagggaatccaaagcatcaacgac 23840625  T
116 atgcgcaacccaatggtctgatcagttaccagccaccgaccattagtgctccacagatcaaacctattggtttcaat 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
23840624 atgcgcaacccaatggtctgatcagttaccagccaccgaccattaatgctccacagatcaaacctattggtttcaat 23840548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 126
Target Start/End: Original strand, 22788508 - 22788616
Alignment:
18 tggaaagatgtcttattataagtttttcgtgctagtattgttacttgcagtt---actctcatcaccaatattgctgcagggaatccaaagcatcaacga 114  Q
    |||||| |||||||||||||| || | |||| |||| ||||| |||||||||   ||| |||||||||||||   |||||| ||||||||||| |||  |    
22788508 tggaaaaatgtcttattataacttatccgtgttagttttgtttcttgcagttaacactatcatcaccaatat---tgcaggaaatccaaagcaccaaata 22788604  T
115 catgcgcaaccc 126  Q
    || |||||||||    
22788605 cacgcgcaaccc 22788616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 152
Target Start/End: Complemental strand, 20571246 - 20571184
Alignment:
90 tgcagggaatccaaagcatcaacgacatgcgcaacccaatggtctgatcagttaccagccacc 152  Q
    ||||||||||||||||||||||  |||||| ||| || |||| | ||||| ||||||||||||    
20571246 tgcagggaatccaaagcatcaaatacatgcccaaaccgatggaccgatcatttaccagccacc 20571184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 152
Target Start/End: Original strand, 23864559 - 23864621
Alignment:
90 tgcagggaatccaaagcatcaacgacatgcgcaacccaatggtctgatcagttaccagccacc 152  Q
    |||||| | |||||||||||||  ||||||||||||| |||| | ||||| ||||||||||||    
23864559 tgcaggaagtccaaagcatcaaatacatgcgcaacccgatggaccgatcatttaccagccacc 23864621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 25779465 - 25779357
Alignment:
18 tggaaagatgtcttattataagtttttcgtgctagtattgttacttgcagtt---actctcatcaccaatattgctgcagggaatccaaagcatcaacga 114  Q
    |||||| |||||||||||||| || | |||| |||| ||||| |||||||||   ||| |||||||||||||   |||||| |||||||||||||||  |    
25779465 tggaaaaatgtcttattataacttatccgtgttagttttgtttcttgcagttaacactatcatcaccaatat---tgcaggaaatccaaagcatcaaata 25779369  T
115 catgcgcaaccc 126  Q
    || |||||||||    
25779368 cacgcgcaaccc 25779357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University