View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14965_low_7 (Length: 431)
Name: NF14965_low_7
Description: NF14965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14965_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 343 - 418
Target Start/End: Original strand, 10210039 - 10210114
Alignment:
| Q |
343 |
atgttggtaaaggagcacgtgctgctcgattacagagaaataaaatggtattgttatatctttatatgttccttgt |
418 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10210039 |
atgttggtaaaggtgcacgtgctgctcgattacagagaaataaaatggtactgttatatctttatatgttccttgt |
10210114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University