View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14966_high_2 (Length: 279)
Name: NF14966_high_2
Description: NF14966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14966_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 40 - 262
Target Start/End: Original strand, 1512780 - 1512991
Alignment:
| Q |
40 |
ggatagattacttggttcatcgaaaactccacattccaagcttttcgcgttacaagatcagtcgcatagtaataagaagatgtagaaaaaagcggaaggt |
139 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
1512780 |
ggatagattacttcgttcatcgaaaactccacattccaagcttttcgcgttacaagatcagtcgcatagtaagaagaagatgtagaa-----------gt |
1512868 |
T |
 |
| Q |
140 |
tatgtggttgaagctgaattctctaagaaggttgcagaatcttctacttaccaaagatatgaaacaattatcgctcaacattagtaaatattatacgaaa |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1512869 |
tatgtggttgaagctgaattctctaagaaggttgcagaatcttctacttaccaaagatatgaaacaattatcgctcaacattagtaaatattatacgaaa |
1512968 |
T |
 |
| Q |
240 |
catcaaacattttttattataac |
262 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
1512969 |
catcaaacaatttttattataac |
1512991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 1512720 - 1512760
Alignment:
| Q |
1 |
aaaacgtaaagatgaagaaatgacaacatcagtcatgctgg |
41 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1512720 |
aaaacgtaaagatgaagaaatgacaacatcagtcatgctgg |
1512760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University