View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14966_high_9 (Length: 206)
Name: NF14966_high_9
Description: NF14966
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14966_high_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 109 - 206
Target Start/End: Original strand, 11077103 - 11077200
Alignment:
| Q |
109 |
attcaatagaatttgcgtgtgtagtggtctttttcgagagtccaatggtaattggttaaagggttacaatcaaagaattatagcttgcttgtggtgcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11077103 |
attcaatagaatttgcgtgtgtagtggtctttttcgagagtccaatggtaattggttaaagggttacaatcaaagaattatagcttgcttgtggtgcc |
11077200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 113
Target Start/End: Complemental strand, 29862004 - 29861918
Alignment:
| Q |
27 |
catgagcaactaaactctctctgattagggttttaaaatgaacctatctttatttcttgaaatccattaatgcaatttctatattca |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||| ||| |||| | ||| ||| ||||||| ||||||| || |||| |||||| |
|
|
| T |
29862004 |
catgagcaactaaactctctttgattagcgttttatgatgtacctctatttgtttgttgaaattaattaatgtaacttctttattca |
29861918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 103
Target Start/End: Complemental strand, 18682395 - 18682319
Alignment:
| Q |
27 |
catgagcaactaaactctctctgattagggttttaaaatgaacctatctttatttcttgaaatccattaatgcaatt |
103 |
Q |
| |
|
||||||||||||||| | |||| ||||||||| ||| |||||||| | ||||||| || ||| |||||||||||| |
|
|
| T |
18682395 |
catgagcaactaaacaccctctaattagggttctaagatgaacctttgtttatttgttaaaagttattaatgcaatt |
18682319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University