View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14967_high_12 (Length: 292)
Name: NF14967_high_12
Description: NF14967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14967_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 269
Target Start/End: Complemental strand, 36378191 - 36377931
Alignment:
| Q |
5 |
tagataattctcgttgcaaatggcattgaagactttgcttcatcaaagaagcatttgaggaggagatatgactacggatatgatgaaagagctcaccaat |
104 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36378191 |
tagataattttcgttgcaaatggcattgaagactttgcttcatcaaagaagcatttgaggaggagatatgactacggat-----gaaagagctcaccaat |
36378097 |
T |
 |
| Q |
105 |
atgagtttaaattttgatccctaatgtttatttatattcatttgttttatgtgaccttggactatccagaagaaaaaccattcaatctccggaaattttt |
204 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36378096 |
atgagtttaaattttgatccctaaagtttatttatattcatttgttttctgtgaccttggactatccagaagaaaaaccattcaatctccggaaattttt |
36377997 |
T |
 |
| Q |
205 |
c-nnnnnnnnttaaattactctttatattttcggttcgccattgttggattcaattgcatatgaat |
269 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36377996 |
caaaaaaaagttaaattactctttatattttcggttcgccattgttggattcaattgcatatgaat |
36377931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 5 - 45
Target Start/End: Complemental strand, 36370679 - 36370639
Alignment:
| Q |
5 |
tagataattctcgttgcaaatggcattgaagactttgcttc |
45 |
Q |
| |
|
||||||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
36370679 |
tagataattttcattgcaaatggcattaaagactttgcttc |
36370639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 5 - 45
Target Start/End: Complemental strand, 36386066 - 36386026
Alignment:
| Q |
5 |
tagataattctcgttgcaaatggcattgaagactttgcttc |
45 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||||| |
|
|
| T |
36386066 |
tagataattttcattgcaaatggcattgaaggctttgcttc |
36386026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University