View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14967_high_15 (Length: 253)
Name: NF14967_high_15
Description: NF14967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14967_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 10 - 196
Target Start/End: Complemental strand, 8034020 - 8033834
Alignment:
| Q |
10 |
agatgaacaaaattttgctgagaggaaccaattttagctttcgatgagaacctgtcttcttatttcagatggaatttccttgcaaagaaccaaaaattct |
109 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8034020 |
agatgaacaaaattttgctgagagaaaccaattttagctttcgatgagaacctgtcttcttatttcagatggaatttccttgcaaaggaccaaaaattct |
8033921 |
T |
 |
| Q |
110 |
gtaggctgttttacgatcgataaaacacccacactgacaacacactgaatcttcgactttttgatattaattttagaaaatatttca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8033920 |
gtaggctgttttacgatcgataaaacacccacactgacaacacactgaatcttcgactttttgatattaattttagaaaataattca |
8033834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 116
Target Start/End: Original strand, 8413838 - 8413944
Alignment:
| Q |
10 |
agatgaacaaaattttg-ctgagaggaaccaattttagctttcgatgagaacctgtcttcttatttcagatggaatttccttgcaaagaaccaaaaattc |
108 |
Q |
| |
|
|||||||||||||||| ||| ||| ||| |||||| ||||| ||||| ||| | ||||||||||||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
8413838 |
agatgaacaaaatttttactgtgagaaactaattttggctttggatgaaaacttatcttcttatttcagatgtaattt-cttgcaaaggaccaaaaattc |
8413936 |
T |
 |
| Q |
109 |
tgtaggct |
116 |
Q |
| |
|
| |||||| |
|
|
| T |
8413937 |
tttaggct |
8413944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University