View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14967_high_18 (Length: 240)
Name: NF14967_high_18
Description: NF14967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14967_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 74 - 223
Target Start/End: Complemental strand, 22274804 - 22274659
Alignment:
| Q |
74 |
tatattttaccaattatgtctgcattttattcttatagtggacatgatgatatgtactgtggcgcatctttatgaagcctttaaattaattgaaagatgt |
173 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22274804 |
tatattttaccaattatgtc-gcattttgttcttatagtggacatgat---atgtattgtggcgcatctttatgaagcctttaaattcattgaaagatgt |
22274709 |
T |
 |
| Q |
174 |
cataaaacatcgtgacaatgcatgagaacatagataaatcattacaaaat |
223 |
Q |
| |
|
|||||||| | || ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22274708 |
cataaaacttggtatcaatgcatgagaacatagacaaatcattacaaaat |
22274659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 22274843 - 22274802
Alignment:
| Q |
1 |
tttgctgcatgtagtatactagcagatcgagaaatggagtat |
42 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22274843 |
tttgctgcatgtagtatgctagcagatcgagaaatggagtat |
22274802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University