View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14967_low_14 (Length: 320)
Name: NF14967_low_14
Description: NF14967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14967_low_14 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 75 - 320
Target Start/End: Complemental strand, 22275198 - 22274957
Alignment:
| Q |
75 |
ctcacaaaaatgatcatcctatcatactgatagtagctagctacacttacctatcggttttatttataagttgcccttcacaatcagttagtttgaagtg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22275198 |
ctcacaaaaatgatcatcctatcatactgatagtagcta----cacttacctatcggttttatttataatttgcccttcacaatcagttagtttgaagtg |
22275103 |
T |
|
| Q |
175 |
gatgtaactaactcttaactactataacaaaataggaaatagctatcacattaactttactagttactagcatagacattcactaactatataatttgtt |
274 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22275102 |
gatgtaactaactcttaactactaaaacaaaataggaaatagctatcacattaactttactagttactagcatagacattcactaactatataatttgtt |
22275003 |
T |
|
| Q |
275 |
gatccacaagctttcatacatacatctttgaaataggttaatcttc |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
22275002 |
gatccacaagctttcatacatacatctttgaaataggttagtcttc |
22274957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 78
Target Start/End: Complemental strand, 22276366 - 22276301
Alignment:
| Q |
13 |
taatactagtactacgaacggacgtgtaccaaaactttatatcacatacgtaatgaattcttctca |
78 |
Q |
| |
|
||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22276366 |
taatattagtactacgaaccgacgtgtaccggaactttatatcacatacgtaatgaattcttctca |
22276301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University