View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14967_low_21 (Length: 257)
Name: NF14967_low_21
Description: NF14967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14967_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 3046998 - 3047200
Alignment:
| Q |
13 |
acttggtttggattagctttttggtctgctgttatttgcatctgattttacaaattgatttaatgttttgtttgtatgttgtaatagaggtcatggctgg |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
3046998 |
acttggtttggattagctttttggtgtgctgttatttgcatctgattttacaaattgatttaatgttttgtttgtatggtgtaatagaggtcattgctgg |
3047097 |
T |
|
| Q |
113 |
ctgtttttctggtatggacatgcaaatacttgttctacttagtttggcttagctttttggtctacttatatattatttgctaatgctacatagtggcatg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3047098 |
ctgtttttctggtatggacatgcaaatacttgttctacttagtttggcttagctttttggtctacttatatattatttgctaatgctacatagtggcatg |
3047197 |
T |
|
| Q |
213 |
atc |
215 |
Q |
| |
|
||| |
|
|
| T |
3047198 |
atc |
3047200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University