View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14967_low_22 (Length: 253)

Name: NF14967_low_22
Description: NF14967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14967_low_22
NF14967_low_22
[»] chr4 (2 HSPs)
chr4 (10-196)||(8033834-8034020)
chr4 (10-116)||(8413838-8413944)


Alignment Details
Target: chr4 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 10 - 196
Target Start/End: Complemental strand, 8034020 - 8033834
Alignment:
10 agatgaacaaaattttgctgagaggaaccaattttagctttcgatgagaacctgtcttcttatttcagatggaatttccttgcaaagaaccaaaaattct 109  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
8034020 agatgaacaaaattttgctgagagaaaccaattttagctttcgatgagaacctgtcttcttatttcagatggaatttccttgcaaaggaccaaaaattct 8033921  T
110 gtaggctgttttacgatcgataaaacacccacactgacaacacactgaatcttcgactttttgatattaattttagaaaatatttca 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
8033920 gtaggctgttttacgatcgataaaacacccacactgacaacacactgaatcttcgactttttgatattaattttagaaaataattca 8033834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 10 - 116
Target Start/End: Original strand, 8413838 - 8413944
Alignment:
10 agatgaacaaaattttg-ctgagaggaaccaattttagctttcgatgagaacctgtcttcttatttcagatggaatttccttgcaaagaaccaaaaattc 108  Q
    ||||||||||||||||  ||| ||| ||| |||||| ||||| ||||| ||| | ||||||||||||||||| ||||| ||||||||| |||||||||||    
8413838 agatgaacaaaatttttactgtgagaaactaattttggctttggatgaaaacttatcttcttatttcagatgtaattt-cttgcaaaggaccaaaaattc 8413936  T
109 tgtaggct 116  Q
    | ||||||    
8413937 tttaggct 8413944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University