View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14967_low_27 (Length: 237)
Name: NF14967_low_27
Description: NF14967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14967_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 33523374 - 33523598
Alignment:
| Q |
1 |
gattcaaaaatcacaaaatcacatattttgggttgaaaaccatccatatttgtgtttttcattactcaac---atgcaagcatccatcccttctctttct |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33523374 |
gattcaaaaatcacaaaatcacatattttgggttgaaaaccatccatatttgtgtttttcattactcaacaacatgcaagcatccatcccttctctttct |
33523473 |
T |
|
| Q |
98 |
tcttccttgtggaatttgaaattccacaacgatggcaacattaattccatcctctttccgagatgatcgtttcctaaattttgagccttttaatacatga |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33523474 |
tcttccttgtggaatttgaaattccacaacgatggcaacattaattccatcctctttccgagatgatcgtttcctaaattttgagccttttaatacatga |
33523573 |
T |
|
| Q |
198 |
tttttgaaattaacatgttgaggat |
222 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
33523574 |
tttttgaaattaacatgttgaggat |
33523598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University