View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14969_high_36 (Length: 265)
Name: NF14969_high_36
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14969_high_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 30644974 - 30644740
Alignment:
| Q |
16 |
attgggtctgtgtcgaagttgaatgtgtattggttacactgtttgcttgctgctgatggatttgctatgttgtcattgtagactagggaggttaaattgt |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30644974 |
attgggtctgtgttgaagttgaatgtgtattggttacactgtttgcttgctgctgatggatttgctatgttgtcattgtagactagggaggttaaattgt |
30644875 |
T |
 |
| Q |
116 |
tgccgaaatctgttcgaggagagcttgttattcgacgcacttgtcggaaaaagatccacgacaggatcatggctgtatctggtatggattacattgcttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30644874 |
tgccgaaatctgttcgaggagagcttgttattcgacgcacttgtcggaaaaagatccacgacaggatcatggctgtatctggtatggattacattgcttt |
30644775 |
T |
 |
| Q |
216 |
ggctgactatggtgctttgaatgttgttagttgat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30644774 |
ggctgactatggtgctttgaatgttgttagttgat |
30644740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University