View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14969_high_47 (Length: 231)
Name: NF14969_high_47
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14969_high_47 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 18 - 215
Target Start/End: Complemental strand, 3114106 - 3113901
Alignment:
| Q |
18 |
gttctgtaaccccctgtcccccctgcctattac--------atttatttacatgtgtgatatgacacataacaa-acattattattctacccgtatccta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
3114106 |
gttctgtaaccccctgtcccccctgcctattactgtattacatttatttacatgtgtgatatgacacataacaacacatttctattctacccgtatccta |
3114007 |
T |
 |
| Q |
109 |
tgaggtattattaacactaacatatttgaattgaccgtgagttttttagaatcacaatgtgtcgttgtaattttaacaaaagttacactttaaaacctca |
208 |
Q |
| |
|
||||| |||||||||| ||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3114006 |
tgagggattattaacatgaacatgattgaattgaccgtgagtttttta-aatcacaatgtgtcgctgtaattttaataaaagttacactttaaaacctca |
3113908 |
T |
 |
| Q |
209 |
acagaat |
215 |
Q |
| |
|
||||||| |
|
|
| T |
3113907 |
acagaat |
3113901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University