View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14969_low_19 (Length: 352)
Name: NF14969_low_19
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14969_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 293; Significance: 1e-164; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 293; E-Value: 1e-164
Query Start/End: Original strand, 20 - 336
Target Start/End: Complemental strand, 44800388 - 44800072
Alignment:
| Q |
20 |
acccatggtttagttgtaggcaacaatggaagtgatgcttctttctttatcattctagctgcatctctaactctaggcctcttctcataatctggatgca |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44800388 |
acccatggtttagttgtaggcaacaatggaagtggtgcttctttctttatcattctagctgcatctctaactctaggtctcttctcataatctggatgca |
44800289 |
T |
 |
| Q |
120 |
cacaaacaagccctaccaataacatcctctccatctcaattacatcaaattcccccatcaatttcggatcagccgcctcaacgagtctattcttttccca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44800288 |
cacaaacaagccctaccaataacatcctctccatctcaattacatcaaattcccccatcaatttcggatcagccgcctcaacgagtctattcttttccca |
44800189 |
T |
 |
| Q |
220 |
cagtttccaaacatagtcaccaatgacagttccatcgtctgcaacaggcttcctcccagtcgcaacttcaattatcacgacaccaaaactatatacatcg |
319 |
Q |
| |
|
||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44800188 |
cagactccaaacatagtcaccaatgacagttccgtcgtctgcaacaggcttcctcccagtcgcaacttcaattatcacgacaccaaaactatatacatca |
44800089 |
T |
 |
| Q |
320 |
gtcttcacggttggaac |
336 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44800088 |
gtcttcacggttggaac |
44800072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University