View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14969_low_20 (Length: 342)
Name: NF14969_low_20
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14969_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 109 - 323
Target Start/End: Complemental strand, 42913492 - 42913275
Alignment:
| Q |
109 |
tgatcaccaacaatgatgcaaaaattgagaagaatgaagaagaggctccaattgagaagagtgaataaggagaaaatgtgtgaagtttatggaagtgttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42913492 |
tgatcaccaacaatgatgcaaaaattgagaagaatgaagaagaggctccaattgagaagagtgaataaggagaaaatgtgtgaagtttatggaagtgttt |
42913393 |
T |
 |
| Q |
209 |
aattagagagagtggttaattacattaatcactttaagttaagtttcattatgtcttgttg---aatgtcttcttcttgttacttgtttagtggtgtaat |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42913392 |
aattagagagagtggttaattacattaatcactttaagttaagtttcactatgtcttgttgtttaatgtctttttcttgttacttgtttagtggtgtaat |
42913293 |
T |
 |
| Q |
306 |
aaaatagctatagtactt |
323 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42913292 |
aaaatagctatagtactt |
42913275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University