View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14969_low_21 (Length: 338)
Name: NF14969_low_21
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14969_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 20 - 327
Target Start/End: Original strand, 30399719 - 30400026
Alignment:
| Q |
20 |
taacttgcactaaaactgtgaatacccaaaataaatctacacttcaaatttatttaatgtaaatttcagaaacacgttacgttacaccaaagaaaaatgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30399719 |
taacttgcactaaaactgtgaatacccaaaataaatctacacttcaaatttatttaatgtaaatttcagaaacacgttacattacaccaaagaaaaatgc |
30399818 |
T |
 |
| Q |
120 |
caaaactagtttaaatctcagtcgtggcatgccactgttcctctgctttctcacacannnnnnnctctgacaactactgaagttgctctgtctctgtctc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30399819 |
caaaactagtttaaatctcagtcgtggcatgccactgttcctctgctttctcacacatttttttctctgacaactactgaagttgctctgtctctgtctc |
30399918 |
T |
 |
| Q |
220 |
tgtctcattcactcatctacttccatcatcaccaacataaaaatgcaaccttttagtttcatcctctcattttctttcacccatttcaaccataacactt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30399919 |
tgtctcattcactcatctacttccatcatcaccaacataaaaatgcaaccttttagtttcatcctctcattttctttcacccatttcaaccataacactt |
30400018 |
T |
 |
| Q |
320 |
catctcac |
327 |
Q |
| |
|
||| |||| |
|
|
| T |
30400019 |
catttcac |
30400026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University