View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14969_low_31 (Length: 300)
Name: NF14969_low_31
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14969_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 9688377 - 9688149
Alignment:
| Q |
18 |
tctactaaatgtgtctattgacttgatactaaattatatggcgaaggtaacatttcacatatcaattttgggtgaactcgatgcaaatggtctattgctt |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
9688377 |
tctactaaatgtgtctattgactttatactaaattatatggcgaaggtaacatttcacatatcaattttgggtgaactcgttgcaaatggtctatggctt |
9688278 |
T |
 |
| Q |
118 |
-----cctttacaacaggtttaccaaaaattgacatgtaaaatgtagttgtcgcggtgtaatttaaaatcttagcaatagacatttaatagaatcaagtg |
212 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
9688277 |
tgattcctttacaacaggtttacccaaaattaacatgtaaaatgtagttgtcgcggtgtaatttaaaatcttagcaatatacatttaatagaatcaagtg |
9688178 |
T |
 |
| Q |
213 |
tctccgcacaaaaattaaaataagaatct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9688177 |
tctccgcacaaaaattaaaataagaatct |
9688149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University