View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14969_low_38 (Length: 272)
Name: NF14969_low_38
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14969_low_38 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 12240000 - 12239748
Alignment:
| Q |
1 |
accaatttcactatcagaactaaaagtatcaagaaatgtctcagcaatcttgaattttcttttcttaatgcaaaaactaatcaacttagaacaagtagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12240000 |
accaatttcactatcagaactaaaagtatcaagaaatgtctcagcaatcttgaattttctattcttaatgcaaaaactaatcaacttagaacaagtagca |
12239901 |
T |
 |
| Q |
101 |
gcatcaggtaaaacatgataaatcttaaaatcttcacaaactgatataaaaaattcccatttcttgaatcttaacaaataccttatcacatggtataagg |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12239900 |
gcatcaggtaaaacatgataaaccttaaaatcttcacaaactgatataaaaaattcccatttcttgaatcttaacaaataccttatcacatggtttaagg |
12239801 |
T |
 |
| Q |
201 |
ttgatttcattggtctaaactctggtctatctttgagtctttgataataatca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12239800 |
ttgatttcattggtctaaactctggtctatctttgagtctttgataataatca |
12239748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University