View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14969_low_46 (Length: 251)
Name: NF14969_low_46
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14969_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 16 - 241
Target Start/End: Original strand, 10703043 - 10703261
Alignment:
| Q |
16 |
cacaagggacgaagctagaatgaggatccgcagtggccacggtcccccaaa-ctttttttatactaatttaacttcnnnnnnnnnnnnaagctagaatgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10703043 |
cacaagggacgaagctagaatgaggatcagcagtggccacggtccccaaaaactttttttatactaatttaactt--------tttttaagctagaatga |
10703134 |
T |
 |
| Q |
115 |
agtagtatgtattatatttcttggtctctaaattttttgtgaacagtcttaagtttatagatttaattgcatcgagattgaccctccgcaccaccggtgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10703135 |
agtagtatgtattatatttcttggtctctaaattttttgtgaacagtcttaagtttatagatttaattgcatcgagattgaccctccgcaccaccggtgg |
10703234 |
T |
 |
| Q |
215 |
cgtccattattatctcgcggatctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
10703235 |
cgtccattattatctcgcggatctctg |
10703261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University