View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14969_low_51 (Length: 248)
Name: NF14969_low_51
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14969_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 30239553 - 30239776
Alignment:
| Q |
18 |
atgccttcaatgtcgaggtaatatatgaaaagtgtccagatttttgtgataactgcaaggttattggtcaccatttatccagatgcaaagatgacaaggg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30239553 |
atgccttcaatgtcgaggtaatatatgaaaagtgtccagatttttgtcataactgcaaggttattggtcaccatttatccagatgcaaagatgacaaggg |
30239652 |
T |
|
| Q |
118 |
caagaagaaagtcctagtcaagaaggatatccaaaaattcattgaaaaaccagctcttgagaaagcaaatcctcccatggacgatactcataagggaagc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30239653 |
caagaagaaagtcctagtcaagaaggatatcaaaaaattcattgaaaaaccagctcttgagaaagcaaatcctcccatggacgatactcataagggaagc |
30239752 |
T |
|
| Q |
218 |
aacgaatctacttcttttcatttc |
241 |
Q |
| |
|
|| | ||||||||||||||||||| |
|
|
| T |
30239753 |
aaagcatctacttcttttcatttc |
30239776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University