View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14969_low_55 (Length: 229)
Name: NF14969_low_55
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14969_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 219
Target Start/End: Complemental strand, 35906727 - 35906528
Alignment:
| Q |
20 |
gatcaaaactttgttgtgaacgaacatagttactgaggacaccccctaggactagttttgccacgagagaaaatggaagcaacagagttggctagaccaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35906727 |
gatcaaaactttgttgtgaacgaacatagttactgaggacaccccctagtactagttttgccacgagagaaaatggaagcaacagagttggctagaccaa |
35906628 |
T |
|
| Q |
120 |
ctactattccaactttgacttgtcctctttttggaattggacgcctagaatttctttgagggatgcttcttcttccactcttcatcatgcctttgcttct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35906627 |
ctactattccaactttgacttgtcctctttttggaattggacgcctagaatttctttgagggatgcttcttcttccactcttcatcatgccattgcttct |
35906528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University