View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1496_high_17 (Length: 203)
Name: NF1496_high_17
Description: NF1496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1496_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 37 - 185
Target Start/End: Complemental strand, 4672730 - 4672588
Alignment:
| Q |
37 |
aattgaatagtggcttatgcaacttgcaatataatcacgggggtacaatatcatgattagtttagtttctttgtatgtcactaaagaatgggacttgagt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4672730 |
aattgaatagtggcttatgcaacttgcaatgtaatcacgggggtacaatatcatgattagtttagtttctttgtatgttactaaagaatgggacttgagt |
4672631 |
T |
|
| Q |
137 |
catctttcccacccttacagttacatcctcttcggtcaaatataagttg |
185 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4672630 |
catctttcccaccct------tacatcctcttcggtcaaatataagttg |
4672588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University