View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1496_low_10 (Length: 284)
Name: NF1496_low_10
Description: NF1496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1496_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 15 - 272
Target Start/End: Original strand, 20580097 - 20580355
Alignment:
| Q |
15 |
aactacttcgttatgaaaacataggagagaagc-agtgaccgtaggagagctttttacccattccttggttcttttcttggtctattctaattgcttcct |
113 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20580097 |
aactacttcgttctgaaaacataggagagaagccagtgaccgtaggagagctttttaccccttccttggttcttttcttggtctattctaattgcttcct |
20580196 |
T |
 |
| Q |
114 |
tcctttatattcaatccgtatctctaaaatattttgtgaaaagttacctatcttggctaacatacggatgcttcactttgttacgtaatgagtgacaatg |
213 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
20580197 |
tcctttatattcaatctgtatctctaaaatattttgtgaaaagttaccgatcttggctaacatacggatgcttcacttcgttacgtaacgagtgacaatg |
20580296 |
T |
 |
| Q |
214 |
gttcacagcccgagggctaattcaggttcctctttatgtggaataaccggtgtaagtat |
272 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||| |||||||||||| |||||| |
|
|
| T |
20580297 |
gttcacagcccgagggctaattcaagttcctctttctgttgaataaccggtgcaagtat |
20580355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University