View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1496_low_12 (Length: 272)
Name: NF1496_low_12
Description: NF1496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1496_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 257
Target Start/End: Complemental strand, 1965872 - 1965632
Alignment:
| Q |
17 |
cattttcgacctacatttcgacaaagtcgatgaagattgggctaaagtaatacctgaattggactatgcaatagtttcaagtggacattggtttttcaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965872 |
cattttcgacctacatttcgacaaagtcgatgaagattgggctaaagtaatacctgaattggactatgcaatagtttcaagtggacattggtttttcaga |
1965773 |
T |
|
| Q |
117 |
ttaatgtaccttcatcaaggtggaaaattactaggctgtgtctattgcagtgnnnnnnntgtcattaaccgagacagtgattttaccctaaggttagcat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
1965772 |
ttaatgtaccttcatcaaggtggaaaattactaggctgtgtctattgcagtgaaaaaaatgtcattaaccgtgacagtgattttacactaaggttagcat |
1965673 |
T |
|
| Q |
217 |
ttgaagcaacattgaattacataaataattgcaaggaatgt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1965672 |
ttgaagcaacattgaattacataaataattgcaaggaatgt |
1965632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University