View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1496_low_13 (Length: 251)
Name: NF1496_low_13
Description: NF1496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1496_low_13 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 79 - 251
Target Start/End: Original strand, 9302129 - 9302301
Alignment:
| Q |
79 |
tgttggaatgagatggaaagagaatttcaatttgtataattatatacgtatggagcaagcaatggggcccacccaagttgtgttacatcactactttact |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9302129 |
tgttggaatgagatggaaagagaatttcaatttgtataattatatacgtatggagcaagcaatggggcccacccaagttgtgttacatcactactttact |
9302228 |
T |
 |
| Q |
179 |
ttacttgatcgccaaggagaaatccagcaagtcaaagtcaactttttgcttgctttgcttggtcatacactat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9302229 |
ttacttgatcgccaaggagaaatccagcaagtcaaagtcaactttttgcttgctttgcttggtcattcactat |
9302301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 13 - 55
Target Start/End: Original strand, 9302065 - 9302107
Alignment:
| Q |
13 |
aattcttaaaagactagtataataagacggagggagtaaatac |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9302065 |
aattcttaaaagactagtataataagacggagggagtaaatac |
9302107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University