View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1496_low_19 (Length: 235)
Name: NF1496_low_19
Description: NF1496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1496_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 63 - 221
Target Start/End: Complemental strand, 43830698 - 43830540
Alignment:
| Q |
63 |
gagagggagaattttcaagattaccttcggtagagatgattgtaatgcaaaggtgtaactcctagttagcttgaagtgaaagattaaggaagaaatttga |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43830698 |
gagagggagaattttcaagattaccttcggtagagatgattgtaatgcaaaggtgtaactcctagttagcttgaagtgaaagatcaaggaagaaatttga |
43830599 |
T |
 |
| Q |
163 |
ggaaaaatgatgaaggatgctgaacagaatgtagaaagagagggaggagtgcgggtttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43830598 |
ggaaaaatgatgaaggatgctgaacagaatgtagaaagagagggaggagtgagggtttt |
43830540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 43830782 - 43830722
Alignment:
| Q |
1 |
aacttgatctatcactttcgtaaaggaaaacgaaaatcaaacctcacacaaacaaaatggt |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43830782 |
aacttgatctatcactttcgtaaaggaaaacgaaaatcaaacctcacacaaacaaaatggt |
43830722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University